Exons and Introns Classifier

BERT finetuned model for classifying DNA sequences into introns and exons, trained on a large cross-species GenBank dataset (34,627 different species).


Architecture

  • Base model: BERT-base-uncased
  • Approach: Full-sequence classification
  • Framework: PyTorch + Hugging Face Transformers

Usage

You can use this model through its own custom pipeline:

from transformers import pipeline

pipe = pipeline(
  task="bert-exon-intron-classification",
  model="GustavoHCruz/ExInBERT",
  trust_remote_code=True,
)

out = pipe(
  {
    "sequence": "GTAAGGAGGGGGATGAGGGGTCATATCTCTTCTCAGGGAAAGCAGGAGCCCTTCAGCAGGGTCAGGGCCCCTCATCTTCCCCTCCTTTCCCAG",
    "organism": "Homo sapiens",
    "gene": "HLA-B",
    "before": "CCGAAGCCCCTCAGCCTGAGATGGG",
    "after": "AGCCATCTTCCCAGTCCACCGTCCC",
  }
)

print(out) # INTRON

This model uses the same maximum context length as the standard BERT (512 tokens), but it was trained on DNA sequences of up to 256 nucleotides. Additional context information (organism, gene, before, after) was also trained using specific rules:

  • Organism and gene names were truncated to 10 characters
  • Flanking sequences before and after were up to 25 nucleotides.

The pipeline follows these rules. Nucleotide sequences, organism, gene, before and after, will be automatically truncated if they exceed the limit.


Custom Usage Information

Prompt format:

The model expects the following input format:

<|SEQUENCE|>[G][T][A][A]...<|ORGANISM|>Homo sapiens<|GENE|>HLA-B<|FLANK_BEFORE|>[C][C][G][A]...<|FLANK_AFTER|>[A][G][C][C]...
  • <|SEQUENCE|>: Full DNA sequence. Maximum of 256 nucleotides.
  • <|ORGANISM|>: Optional organism name (truncated to a maximum of 10 characters in training).
  • <|GENE|>: Optional gene name (truncated to a maximum of 10 characters in training).
  • <|FLANK_BEFORE|> and <|FLANK_AFTER|>: Optional upstream/downstream context sequences. Maximum of 25 nucleotides.

The model should predict the class label: 0 (Exon) or 1 (Intron).


Dataset

The model was trained on a processed version of GenBank sequences spanning multiple species, available at the DNA Coding Regions Dataset.


Publications


Training

  • Trained on an architecture with 8x H100 GPUs.

Metrics

Average accuracy: 0.9996

Class Precision Recall F1-Score
Intron 0.9994 0.9994 0.9994
Exon 0.9997 0.9997 0.9997

Notes

  • Metrics were computed on a full isolated test set.
  • The classes follow a ratio of approximately 2 exons to one intron, allowing for direct interpretation of the scores.
  • The model can operate on raw nucleotide sequences without additional biological features (e.g. organism, gene, before or after).

GitHub Repository

The full code for data processing, model training, and inference is available on GitHub:
CodingDNATransformers

You can find scripts for:

  • Preprocessing GenBank sequences
  • Fine-tuning models
  • Evaluating and using the trained models
Downloads last month
4
Safetensors
Model size
0.1B params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support

Model tree for GustavoHCruz/ExInBERT

Finetuned
(6596)
this model

Collection including GustavoHCruz/ExInBERT